Protein to DNA · Degenerate PCR Primers · Codon Optimization

Reverse Translation Tool (Protein to DNA)

The Reverse Translation Tool back-translates protein or peptide amino acid sequences into DNA coding sequences (5′ to 3′). It supports two primary molecular biology workflows: generating host-optimized DNA for recombinant gene synthesis and generating consensus IUPAC degenerate sequences for PCR primer cloning.

Peptide Input & Reverse Translation Settings

Enter single-letter (DYKDDDDK) or three-letter amino acid sequences. Select highest frequency or degenerate IUPAC output.

Presets:

Peptide Sequence (N-terminal → C-terminal)8 amino acids

Target Host Organism

Reverse Translation Strategy

Append C-terminal Stop Codon

Stop Codon:

CDS Length

27bp / nt

8 residues + 1 stop

GC Content

48.1%

✓ Ideal range (45–60%)

Total Degeneracy

256×

Unique primer pool variants

Estimated Tm Range

59.7–59.7°C

Nearest-neighbor approx.

Reverse Translated DNA Sequence (5′ → 3′)

Synthesized DNA sequence ready for cloning, gene synthesis, or primer synthesis.

GACTACAAGGACGACGACGACAAGTAA

💡 Consensus IUPAC Degenerate Sequence for PCR primers:

GAYTAYAARGAYGAYGAYGAYAARTAA

Residue-by-Residue Reverse Translation Alignment

Detailed breakdown of selected codons, host synonymous fraction, and degenerate options.

#	Residue	Selected Codon	Host Fraction	IUPAC Codon	Degeneracy
1	D	GAC	54.0%	GAY	2×
2	Y	TAC	57.0%	TAY	2×
3	K	AAG	58.0%	AAR	2×
4	D	GAC	54.0%	GAY	2×
5	D	GAC	54.0%	GAY	2×
6	D	GAC	54.0%	GAY	2×
7	D	GAC	54.0%	GAY	2×
8	K	AAG	58.0%	AAR	2×

Principles of Reverse Translation: Overcoming Genetic Code Degeneracy

The standard genetic code is degenerate: 20 standard amino acids are encoded by 61 sense codons. While DNA-to-protein translation is deterministic (one codon specifies exactly one amino acid), reverse translation is inherently one-to-many. For instance, Serine and Leucine are each encoded by 6 different codons, while Methionine and Tryptophan have only 1 codon each.

1. Most Frequent Host Codon (Recombinant Gene Synthesis)

Selects the single synonymous codon with the highest frequency in the target expression host (e.g., E. coli, Yeast, Human, or CHO). This eliminates rare codons, elevates translation elongation velocity, and minimizes premature termination in recombinant overexpression vectors.

2. IUPAC Degenerate Oligonucleotide (PCR Primer Design)

Constructs an ambiguous consensus sequence using standard IUPAC nucleotide codes (e.g., R, Y, S, W, K, M, B, D, H, V, N) that covers all possible codon variants for the target peptide. Essential for designing degenerate PCR primers to amplify homologous genes, unsequenced orthologs, or antibodies from peptide fragments.

Degenerate Primer Molecular Architecture & 3′-Anchor Principle

Visualizes how peptide sequence degeneracy multiplies in oligonucleotide pools, why low-degeneracy 3′-anchoring is critical for Taq extension, and how wobble bases anneal to unknown genomic targets.

1. Primer Concentration AdjustmentBecause a 32-fold degenerate primer pool divides each specific oligo into 1/32 of total mass, increase final primer concentration from typical 0.2 μM to 0.6–1.0 μM.

2. Touchdown PCR StrategyStart annealing 5°C above the calculated lowest Tm, decreasing by 1°C per cycle for 10 cycles. This ensures early cycles amplify only high-stringency specific products.

3. 3′-Terminus Anchor SelectionNever place Arg (CGN/AGR, 6-fold) or Ser (TCN/AGY, 6-fold) at the 3′-end. Always choose Met, Trp, Phe, Tyr, or Cys for the final two 3′ codons.

🧬 Step-by-Step Bench Worked Example

Practical Walkthrough: Cloning a Novel Homeobox Transcription Factor Using Peptide Motif W-F-Q-N-R-R

Scenario: You perform de novo tandem mass spectrometry (MS/MS) on an unsequenced marine sponge species and identify a highly conserved 6-amino-acid DNA-binding motif: Trp-Phe-Gln-Asn-Arg-Arg. Follow this step-by-step guide to reverse-translate it into a high-efficiency degenerate forward PCR primer.

1Step 1: Amino Acid Codon Breakdown & Degeneracy Fold Calculation

Position	Residue	Possible Codons	IUPAC Consensus	Degeneracy
1	Trp (W)	TGG	TGG	1-fold
2	Phe (F)	TTT, TTC	TTY (Y = C/T)	2-fold
3	Gln (Q)	CAA, CAG	CAR (R = A/G)	2-fold
4	Asn (N)	AAT, AAC	AAY (Y = C/T)	2-fold
5	Arg (R)	CGT, CGC, CGA, CGG	CGN (N = A/C/G/T)	4-fold (subset)
6	Arg (R, 3′-end)	CGT, CGC	CGY (omit 3rd wobble)	2-fold

Total Oligonucleotide Library Complexity:1 × 2 × 2 × 2 × 4 × 2 = 64-Fold

2Step 2: Generated IUPAC Primer Sequence for Oligo Ordering

Forward Primer (18 nt, 64-fold degeneracy):

5′- TGG TTY CAR AAY CGN CGY -3′

Estimated Tm Range: 48.2°C – 58.6°C | GC Content: 44.4% – 66.7%

3Step 3: Recommended Wet-Lab PCR Thermocycling Protocol

PCR Reaction Setup (50 μL)

• 2× High-Fidelity Master Mix: 25 μL
• Sponge Genomic DNA (100 ng): 2.0 μL
• Degenerate Fwd Primer (20 μM): 2.0 μL (0.8 μM final)
• Degenerate Rev Primer (20 μM): 2.0 μL (0.8 μM final)
• Nuclease-free water: to 50 μL

Touchdown Cycling Program

• Initial Denaturation: 95°C for 3 min
• Phase 1 (10 cycles): 95°C 30s → 62°C to 52°C (-1°C/cycle) 30s → 72°C 45s
• Phase 2 (25 cycles): 95°C 30s → 52°C 30s → 72°C 45s
• Final Extension: 72°C for 5 min

IUPAC Ambiguity Code Reference Table for Degenerate Primers

Standard International Union of Pure and Applied Chemistry (IUPAC) nucleotide symbols used to represent degenerate nucleotide positions in back-translated primers:

IUPAC Symbol	Bases Represented	Origin / Mnemonic	Typical Codon Usage
R	A, G	puRine	Glu (GAR), Lys (AAR), Gln (CAR)
Y	C, T (U)	pYrimidine	Phe (TTY), Tyr (TAY), His (CAY), Asn (AAY), Asp (GAY), Cys (TGY)
S	G, C	Strong hydrogen bonds (3 H-bonds)	Part of Ser/Arg degenerate mixes
W	A, T	Weak hydrogen bonds (2 H-bonds)	Part of Ser degenerate mixes
M	A, C	aMino group	Arg consensus (MGN)
K	G, T	Keto group	G or T wobble
H	A, C, T	not G (H comes after G)	Ile consensus (ATH: ATT, ATC, ATA)
B	C, G, T	not A (B comes after A)	C, G, or T
V	A, C, G	not T (V comes after U)	A, C, or G
D	A, G, T	not C (D comes after C)	A, G, or T
N	A, C, G, T	aNy nucleotide	Ala (GCN), Gly (GGN), Pro (CCN), Thr (ACN), Val (GTN)

Practical Tips for Designing Degenerate PCR Primers

Limit Total Degeneracy Fold (< 512×)

Total degeneracy is the mathematical product of the degeneracy at each position. Keep total degeneracy below 512-fold (ideally < 128-fold); excessively high degeneracy dilutes the concentration of the correct primer species and triggers non-specific PCR bands.

Anchor the 3′-End with Low-Degeneracy Residues

Position the 3′-terminus of your PCR primer on amino acids with minimal degeneracy, such as Met (ATG, 1-fold), Trp (TGG, 1-fold), Cys (TGY, 2-fold), Phe (TTY, 2-fold), or Tyr (TAY, 2-fold). Avoid placing Leu, Ser, or Arg (6-fold) at the extreme 3′-end.

Inosine (I) as an Alternative Universal Base

For 4-fold degenerate positions (e.g., the third wobble base of Ala, Gly, Pro, Thr, Val), deoxyinosine (dI) can pair neutrally with A, C, T, and G, substantially reducing library complexity without inflating primer price.

Related Sequence Analysis Tools

Explore complementary sequence translation, codon usage, and primer formulation tools:

Frequently Asked Questions

Why can’t reverse translation produce the original native DNA sequence?

Because 18 of the 20 amino acids are encoded by 2, 3, 4, or 6 different synonymous codons. Without knowing the exact genomic source, reverse translation can only predict the most probable codon or generate a degenerate IUPAC consensus.

How do I convert a 3-letter peptide sequence into DNA?

You can paste three-letter formatted peptides (e.g., Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys or DYKDDDDK) directly into the sequence box. The tool automatically detects and converts three-letter abbreviations into single-letter format.

What is degeneracy fold in degenerate primer design?

Degeneracy fold is the total number of unique physical oligonucleotide sequences in the primer synthesis mixture. For example, a primer containing two "R" positions (2×2) and one "N" position (4) has a total degeneracy fold of 2 × 2 × 4 = 16.

Which stop codon is best for reverse translation?

TAA (Ochre) is the universal standard in bacteria and yeast due to minimal suppression/readthrough. TGA (Opal) is frequently used in mammalian constructs.

Recommend Tools

Codon Usage Frequency Calculator

Bioinformatics

Count codons from DNA/RNA/FASTA input and compare codon frequency, GC3, and rare codons against expression hosts

IC50 & EC50 Calculator (Dose-Response)

Bioinformatics

Fit dose-response assay curves with 4-parameter logistic (4PL) Hill equations, calculate IC50, EC50, Hill slope, and convert to Ki using Cheng-Prusoff

Enzyme Kinetics Calculator (Km & Vmax)

Bioinformatics

Fit Michaelis-Menten hyperbolic velocity and Lineweaver-Burk double reciprocal plots to calculate Km, Vmax, kcat turnover, and catalytic efficiency

Explore All Lab Calculators →