DNA to RNA Converter
Transcribe DNA sequences to complementary RNA sequences
DNA to RNA Converter
Transcribe your DNA sequence into a complementary RNA sequence.
Results
RNA Result
Your RNA sequence will appear here.
How to Use
1Paste your DNA sequence into the input box.
2Click the "Transcribe" button to get the RNA sequence.
3Copy or download the resulting RNA sequence.
Supported Formats
- • Raw sequence
- • FASTA format
- • Sequence with spaces or line breaks
Transcription Information
Transcription is the process of creating a complementary RNA copy of a DNA sequence.
Base Pairing Rules
A → U
T → A
G → C
C → G
Example
Input DNA:
>sample_sequence
ATGGCATAAAGCTTGGCCTTAGC
ATGGCATAAAGCTTGGCCTTAGC
Output RNA:
UACCGUAUUUCGAACCGGAAUC
Transcription Process
The process of transcription from DNA to RNA involves creating a complementary RNA copy of a DNA sequence.
Key Points
- Transcription is initiated at a promoter region on the DNA.
- The enzyme RNA polymerase reads the DNA template and synthesizes a complementary RNA strand.
- In the RNA strand, Uracil (U) replaces Thymine (T).
- Transcription stops at a terminator sequence.
Applications
Understanding DNA to RNA transcription is fundamental to many areas of molecular biology and genetics.
Use Cases
- Gene expression analysis.
- Genetic engineering and recombinant DNA technology.
- Diagnostic testing for genetic diseases.
- Forensic science.