DNA to RNA Converter

Convert DNA sequences to RNA notation by replacing T with U.

DNA to RNA Converter

Paste a DNA sequence or FASTA record to generate RNA notation with T replaced by U.

Results

RNA Result

Your RNA sequence will appear here.

How to Use

1Paste your DNA sequence into the input box.
2Click the "Transcribe" button to get the RNA sequence.
3Copy or download the resulting RNA sequence.

Supported Formats

  • Raw sequence
  • FASTA format
  • Sequence with spaces or line breaks

Transcription Information

This tool treats the input as a coding DNA strand and replaces T with U. If you are using a template strand, check strand direction and complement rules separately.

Replacement used here

A → U
T → U
G → G
C → C

Example

Input DNA:
>sample_sequence
ATGGCATAAAGCTTGGCCTTAGC
Output RNA:
AUGGCAUAAAGCUUGGCCUUAGC

Transcription Process

When using codon tables or RNA translation tools, DNA T is read as RNA U.

Key Points

  • For a coding DNA strand, replacing T with U gives RNA notation.
  • For a template strand, verify the complement and strand direction.
  • Codon tables are commonly read in RNA notation using A/U/G/C.
  • For translation, also check the reading frame and start codon.

Applications

Understanding DNA to RNA transcription is fundamental to many areas of molecular biology and genetics.

Use Cases

  • Gene expression analysis.
  • Genetic engineering and recombinant DNA technology.
  • Diagnostic testing for genetic diseases.
  • Forensic science.