RNA to Protein Converter

Convert RNA sequences to protein sequences

RNA to Protein Converter

Translate your RNA sequence into a protein sequence using various genetic codes and reading frames.

Results

1

5'→3' Frame 1

Forward strand

Frame 1 translation will appear here.

How to Use

1Paste your RNA sequence into the input box.
2Select the genetic code and reading frame.
3Click the "Translate" button.
4View the results in the tabs below.

Supported Formats

  • Raw sequence
  • FASTA format
  • Sequence with spaces or line breaks

Reading Frames Information

Translation can begin at any of three positions on the RNA sequence. These are called reading frames.

Forward Frames

+1: Starts from the first nucleotide.
+2: Starts from the second nucleotide.
+3: Starts from the third nucleotide.

All Frames Information

View the translation for all three forward reading frames.

Example

Input RNA:
>sample_sequence
AUGGCAUAAAGCUUGGCCUUAGC
Output Protein:
MA*SLAL

Translation Process

The process of translation from RNA to protein involves reading codons (three-nucleotide sequences) and translating them into amino acids.

Key Points

  • Translation starts at a start codon (usually AUG).
  • Each codon corresponds to a specific amino acid.
  • Translation stops at a stop codon.
  • The resulting sequence of amino acids forms a protein.

Genetic Codes

Most RNA sequences use the standard genetic code. For vertebrate mitochondrial RNA, choose the mitochondrial code to apply different assignments for some codons.

Available codes

  • Standard Genetic Code
  • Vertebrate Mitochondrial Code