DNA to Proteins Converter
Convert DNA sequences to protein sequences with support for multiple genetic codes and reading frames
DNA to Protein Converter
Quick Tips
Paste a FASTA header line starting with > and the tool will parse sequence lines below.
Try multiple frames if you see unexpected stop codons or very short proteins.
This tool internally converts T to U for codon lookup.
Reading Frames
DNA can be read in 6 different reading frames to produce different proteins.
Forward Frames (+):
Reverse Frames (-):
All 6 Frames:
Select "All 6 frames" to translate DNA in all possible reading frames simultaneously.
Example
ATGGCATAAAGCTTGGCCTTAGC
How to Use
- Paste your DNA sequence (raw text or FASTA) into the input box.
- Select a reading frame (or translate all 6 frames).
- Review the protein output and any warnings (e.g., unexpected stop codons).
- Copy or download results, and verify specific codons using the Codon Table if needed.
Related Guides
FAQ
Why do I see many stop codons in the output?
Common causes include choosing the wrong reading frame, translating the wrong strand, or using an incompatible genetic code (especially for mitochondrial genes). Try translating all frames and switching the genetic code table.
Does this tool support FASTA input?
Yes. Paste a FASTA header line starting with > and the tool will parse the sequence lines below it.
What is the start codon for translation?
AUG (ATG in DNA) commonly encodes Methionine and acts as the canonical start codon in the standard code. Some organisms and organelles can have variations.