RNA to Protein Converter
Convert RNA sequences to protein sequences
RNA to Protein Converter
Translate your RNA sequence into a protein sequence using various genetic codes and reading frames.
Results
1
5'→3' Frame 1
Forward strand
Frame 1 translation...
How to Use
1Paste your RNA sequence into the input box.
2Select the genetic code and reading frame.
3Click the "Translate" button.
4View the results in the tabs below.
Supported Formats
- • Raw sequence
- • FASTA format
- • Sequence with spaces or line breaks
Reading Frames Information
Translation can begin at any of three positions on the RNA sequence. These are called reading frames.
Forward Frames
+1: Starts from the first nucleotide.
+2: Starts from the second nucleotide.
+3: Starts from the third nucleotide.
All Frames Information
View the translation for all three forward reading frames.
Example
Input RNA:
>sample_sequence
AUGGCAUAAAGCUUGGCCUUAGC
AUGGCAUAAAGCUUGGCCUUAGC
Output Protein:
MA*SLAL
Translation Process
The process of translation from RNA to protein involves reading codons (three-nucleotide sequences) and translating them into amino acids.
Key Points
- Translation starts at a start codon (usually AUG).
- Each codon corresponds to a specific amino acid.
- Translation stops at a stop codon.
- The resulting sequence of amino acids forms a protein.
Genetic Codes
Different organisms use slightly different genetic codes. This tool supports the standard genetic code and vertebrate mitochondrial code.
Available Codes:
- Standard Genetic Code
- Vertebrate Mitochondrial Code