DNA to Proteins Converter

Convert DNA sequences to protein sequences with support for multiple genetic codes and reading frames

DNA to Protein Converter

Enter your DNA sequence and select genetic code to translate into protein sequences

Translation Results

1

5'→3' Frame 1

Forward strand

Frame +1 translation...

How to Use

This tool converts DNA sequences to protein sequences using the genetic code. Simply paste your DNA sequence, select the appropriate genetic code table, and choose your reading frame.

Supported Formats:

  • • Raw sequence (ATCG...)
  • • FASTA format
  • • Spaces and numbers ignored

Reading Frames

DNA can be read in 6 different reading frames to produce different protein.

Forward Frames (+):

+1: Start from position 1
+2: Start from position 2
+3: Start from position 3

Reverse Frames (-):

-1: Reverse complement +1
-2: Reverse complement +2
-3: Reverse complement +3

All 6 Frames:

Select "All 6 frames" to translate DNA in all possible reading frames simultaneously. This shows all potential protein sequences that could be encoded by your DNA sequence.

Example

Input FASTA:
>sample_sequence
ATGGCATAAAGCTTGGCCTTAGC
Output Protein (+1 frame):
MA*SLAL

How to Use

  1. Paste your DNA sequence (raw text or FASTA) into the input box.
  2. Select a reading frame (or translate all 6 frames).
  3. Review the protein output and any warnings (e.g., unexpected stop codons).
  4. Copy or download results, and verify specific codons using the Codon Table if needed.

FAQ

Why do I see many stop codons in the output?

Common causes include choosing the wrong reading frame, translating the wrong strand, or using an incompatible genetic code (especially for mitochondrial genes). Try translating all frames and switching the genetic code table.

Does this tool support FASTA input?

Yes. Paste a FASTA header line starting with > and the tool will parse the sequence lines below it.

What is the start codon for translation?

AUG (ATG in DNA) commonly encodes Methionine and acts as the canonical start codon in the standard code. Some organisms and organelles can have variations.